Review



paired single-guide rnas (sgrnas)  (Benchling Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Benchling Inc paired single-guide rnas (sgrnas)
    Paired Single Guide Rnas (Sgrnas), supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paired+single-guide+rnas+(sgrnas)/single+guide+rnas/pm39318126-56-4-12
    Average 90 stars, based on 1 article reviews
    paired single-guide rnas (sgrnas) - by Bioz Stars, 2026-10
    90/100 stars

    Images



    Similar Products

    paired single-guide rnas (sgrnas)  (Benchling Inc)
    90
    Benchling Inc paired single-guide rnas (sgrnas)
    Paired Single Guide Rnas (Sgrnas), supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paired+single-guide+rnas+(sgrnas)/single+guide+rnas/pm39318126-56-4-12
    Average 90 stars, based on 1 article reviews
    paired single-guide rnas (sgrnas) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    a pair of single guide rnas(sgrna) targeting cyr61  (Addgene inc)
    90
    Addgene inc a pair of single guide rnas(sgrna) targeting cyr61
    A. <t>Cyr61</t> mRNA hepatocyte expression under the indicated conditions. Transcripts per million base pairs (TPM).
    A Pair Of Single Guide Rnas(sgrna) Targeting Cyr61, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paired+single-guide+rnas+(sgrnas)/a+pair+of+single+guide+rnas+sgrna++targeting+cyr61/pmc07062580-103-6-25
    Average 90 stars, based on 1 article reviews
    a pair of single guide rnas(sgrna) targeting cyr61 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A. Cyr61 mRNA hepatocyte expression under the indicated conditions. Transcripts per million base pairs (TPM).

    Journal: Hepatology (Baltimore, Md.)

    Article Title: Hepatocyte Stress Increases Expression of YAP and TAZ in Hepatocytes to Promote Parenchymal Inflammation and Fibrosis

    doi: 10.1002/hep.30928

    Figure Lengend Snippet: A. Cyr61 mRNA hepatocyte expression under the indicated conditions. Transcripts per million base pairs (TPM).

    Article Snippet: To perform in vivo deletion of hepatocyte Cyr61, a pair of single guide RNAs(sgRNA) targeting Cyr61 were designed(sgCyr61–1: CTTCTCCACTTGACCAGACTG, sgCyr61–3: CTCAGCCCTGCGACCACACCA) and cloned into pX602-AAV-TBG-saCas9( Addgene.org , Cat# 61593).

    Techniques: Expressing